Transcript: Human XM_005248121.3

PREDICTED: Homo sapiens SLAIN motif family member 2 (SLAIN2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLAIN2 (57606)
Length:
5053
CDS:
266..2089

Additional Resources:

NCBI RefSeq record:
XM_005248121.3
NBCI Gene record:
SLAIN2 (57606)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005248121.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253839 ATCGGTTAGTCCATTAGTTTG pLKO_005 697 CDS 100% 10.800 15.120 N SLAIN2 n/a
2 TRCN0000253838 TGCGACCTCCTATAGTCAAAC pLKO_005 924 CDS 100% 10.800 15.120 N SLAIN2 n/a
3 TRCN0000253837 TATCCACAAACTTGATCAAAC pLKO_005 775 CDS 100% 10.800 7.560 N SLAIN2 n/a
4 TRCN0000253840 TTTCACCATCACCACGCAATT pLKO_005 1290 CDS 100% 10.800 7.560 N SLAIN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005248121.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03835 pDONR223 100% 95.7% 95.5% None 1361_1438del n/a
2 ccsbBroad304_03835 pLX_304 0% 95.7% 95.5% V5 1361_1438del n/a
3 TRCN0000477057 CTAGTAGACCTTGTTCCTCTTGGT pLX_317 20.8% 95.7% 95.5% V5 1361_1438del n/a
Download CSV