Transcript: Human XM_005248994.2

PREDICTED: Homo sapiens zinc finger protein 451 (ZNF451), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF451 (26036)
Length:
5049
CDS:
215..3142

Additional Resources:

NCBI RefSeq record:
XM_005248994.2
NBCI Gene record:
ZNF451 (26036)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005248994.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413031 GTATTCTAATATAGGTGTAAC pLKO_005 3438 3UTR 100% 10.800 15.120 N ZNF451 n/a
2 TRCN0000154370 CGTTTACACATGAGCCGGATT pLKO.1 1754 CDS 100% 4.050 5.670 N ZNF451 n/a
3 TRCN0000150741 GCTTTAATTAGAGCAGCACAT pLKO.1 3795 3UTR 100% 4.050 5.670 N ZNF451 n/a
4 TRCN0000152527 GCTCCTTTGCTTGTGTAGTAT pLKO.1 843 CDS 100% 5.625 4.500 N ZNF451 n/a
5 TRCN0000153827 CGAGGACATTCTGATACAGAA pLKO.1 578 CDS 100% 4.950 3.960 N ZNF451 n/a
6 TRCN0000154426 GCTTTAACTCTGGCTCGTCTA pLKO.1 449 CDS 100% 4.050 3.240 N ZNF451 n/a
7 TRCN0000365130 AGCAAACACAATGGGTTATAA pLKO_005 1690 CDS 100% 15.000 10.500 N ZNF451 n/a
8 TRCN0000365131 TCTCATGTGGCACTATTATAT pLKO_005 3656 3UTR 100% 15.000 10.500 N ZNF451 n/a
9 TRCN0000365132 ACAAGCCTTCATCAGCTATTA pLKO_005 1965 CDS 100% 13.200 9.240 N ZNF451 n/a
10 TRCN0000150985 CGTGAGAGTTACATCTGTAAA pLKO.1 2387 CDS 100% 13.200 9.240 N ZNF451 n/a
11 TRCN0000370136 GGAATTAGAAGAAGCTATTAG pLKO_005 3171 3UTR 100% 13.200 9.240 N ZNF451 n/a
12 TRCN0000151451 CCTTTGCTTGTGTAGTATGTT pLKO.1 846 CDS 100% 5.625 3.938 N ZNF451 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005248994.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11803 pDONR223 100% 95.3% 93.9% None (many diffs) n/a
2 ccsbBroad304_11803 pLX_304 0% 95.3% 93.9% V5 (many diffs) n/a
Download CSV