Transcript: Human XM_005248999.2

PREDICTED: Homo sapiens glucosaminyl (N-acetyl) transferase 2 (I blood group) (GCNT2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GCNT2 (2651)
Length:
4319
CDS:
581..1558

Additional Resources:

NCBI RefSeq record:
XM_005248999.2
NBCI Gene record:
GCNT2 (2651)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005248999.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004934 GCTAACAAGTTTGAGCTTAAT pLKO.1 1442 CDS 100% 13.200 18.480 N GCNT2 n/a
2 TRCN0000004935 CCACAAAGACTTCGGCACTTT pLKO.1 658 CDS 100% 4.950 6.930 N GCNT2 n/a
3 TRCN0000004936 CGAAGCCACTATGTAACAGAA pLKO.1 587 CDS 100% 4.950 6.930 N GCNT2 n/a
4 TRCN0000004932 GCTCACCTCTATATTAGTTTA pLKO.1 1796 3UTR 100% 13.200 10.560 N GCNT2 n/a
5 TRCN0000004933 GCCACTATGTACATGGTATTT pLKO.1 1368 CDS 100% 13.200 9.240 N GCNT2 n/a
6 TRCN0000165425 GATCACTTGATGCCAGGAGTT pLKO.1 3748 3UTR 100% 4.050 2.025 Y ALKBH4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005248999.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06267 pDONR223 100% 66.9% 67.4% None (many diffs) n/a
2 ccsbBroad304_06267 pLX_304 0% 66.9% 67.4% V5 (many diffs) n/a
3 TRCN0000475705 TGCCATGTATATCCAGGCCACCGA pLX_317 26.8% 66.9% 67.4% V5 (many diffs) n/a
Download CSV