Transcript: Human XM_005249232.3

PREDICTED: Homo sapiens WRN helicase interacting protein 1 (WRNIP1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WRNIP1 (56897)
Length:
1602
CDS:
283..1542

Additional Resources:

NCBI RefSeq record:
XM_005249232.3
NBCI Gene record:
WRNIP1 (56897)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005249232.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436158 ATGATGTGCGAGATGTCATAA pLKO_005 1190 CDS 100% 13.200 18.480 N WRNIP1 n/a
2 TRCN0000004527 CGCTGTCGAGTGATTGTTCTT pLKO.1 1393 CDS 100% 4.950 6.930 N WRNIP1 n/a
3 TRCN0000103762 GCATAAGGTTTGTGACATTAT pLKO.1 1148 CDS 100% 13.200 9.240 N Wrnip1 n/a
4 TRCN0000004528 ACAGCAAGAAACATAGCATAA pLKO.1 1133 CDS 100% 10.800 7.560 N WRNIP1 n/a
5 TRCN0000436134 GTGACATTATCTGCAACAAAT pLKO_005 1159 CDS 100% 13.200 7.920 N WRNIP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005249232.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000469615 ACATTTTGACAGATCCACTTGCCT pLX_317 16.6% 58.9% 59% V5 (many diffs) n/a
Download CSV