Transcript: Human XM_005249950.4

PREDICTED: Homo sapiens GTPase, IMAP family member 8 (GIMAP8), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GIMAP8 (155038)
Length:
3867
CDS:
255..2252

Additional Resources:

NCBI RefSeq record:
XM_005249950.4
NBCI Gene record:
GIMAP8 (155038)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005249950.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423380 GGTAATTGCCATCGGCCATTT pLKO_005 551 CDS 100% 10.800 8.640 N GIMAP8 n/a
2 TRCN0000048334 CCATCTTTGGAGCAGACTTTA pLKO.1 1903 CDS 100% 13.200 9.240 N GIMAP8 n/a
3 TRCN0000048335 GCTCCGGACATCTCATCTTTA pLKO.1 1161 CDS 100% 13.200 9.240 N GIMAP8 n/a
4 TRCN0000425556 ATGAGGGCCGATACTGCATTT pLKO_005 736 CDS 100% 10.800 7.560 N GIMAP8 n/a
5 TRCN0000048333 CCCTATCATGTGAACTTCAAA pLKO.1 849 CDS 100% 5.625 3.938 N GIMAP8 n/a
6 TRCN0000048336 CAAAGGTCAATGATCTGAGAA pLKO.1 2110 CDS 100% 4.950 3.465 N GIMAP8 n/a
7 TRCN0000048337 CCTCTCAAGCAGTTGGTTCAA pLKO.1 711 CDS 100% 4.950 3.465 N GIMAP8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005249950.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09712 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_09712 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480100 AATTAACTCCTGAATATTCTTATT pLX_317 18.7% 100% 100% V5 n/a
Download CSV