Transcript: Human XM_005249952.4

PREDICTED: Homo sapiens crystallin gamma N (CRYGN), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CRYGN (155051)
Length:
807
CDS:
162..710

Additional Resources:

NCBI RefSeq record:
XM_005249952.4
NBCI Gene record:
CRYGN (155051)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005249952.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156876 GCCTAGAAATCTTCGAGGGTT pLKO.1 448 CDS 100% 2.640 3.696 N CRYGN n/a
2 TRCN0000157301 CAATCAGATCAAGGACCGGAA pLKO.1 751 3UTR 100% 2.160 3.024 N CRYGN n/a
3 TRCN0000153365 GAGAACATTTCCGCCTAGAAA pLKO.1 436 CDS 100% 5.625 4.500 N CRYGN n/a
4 TRCN0000157345 CTGGGTCAAGAACTGTGTGAA pLKO.1 530 CDS 100% 4.950 3.465 N CRYGN n/a
5 TRCN0000152911 GAACTGTGTGAACACCATCAA pLKO.1 539 CDS 100% 4.950 3.465 N CRYGN n/a
6 TRCN0000152640 GCTTTATGAACCGAGTGAACT pLKO.1 262 CDS 100% 4.950 3.465 N CRYGN n/a
7 TRCN0000156875 GTAGGAATGCACGGAGAACAT pLKO.1 423 CDS 100% 4.950 3.465 N CRYGN n/a
8 TRCN0000158203 CTCTATGAAGGCAAGCACTTC pLKO.1 189 CDS 100% 4.050 2.835 N CRYGN n/a
9 TRCN0000156570 GAGCAGCTCTCTTCAATCAGA pLKO.1 738 3UTR 100% 3.000 2.100 N CRYGN n/a
10 TRCN0000153909 CAAGAACTGTGTGAACACCAT pLKO.1 536 CDS 100% 2.640 1.848 N CRYGN n/a
11 TRCN0000153528 CTCTTCAATCAGATCAAGGAC pLKO.1 746 3UTR 100% 2.640 1.848 N CRYGN n/a
12 TRCN0000157593 GTGAACACCATCAAGGTGTAC pLKO.1 546 CDS 100% 0.405 0.284 N CRYGN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005249952.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05086 pDONR223 100% 80.6% 76.5% None (many diffs) n/a
2 ccsbBroad304_05086 pLX_304 0% 80.6% 76.5% V5 (many diffs) n/a
Download CSV