Transcript: Human XM_005249979.4

PREDICTED: Homo sapiens DENN domain containing 2A (DENND2A), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DENND2A (27147)
Length:
2578
CDS:
305..2533

Additional Resources:

NCBI RefSeq record:
XM_005249979.4
NBCI Gene record:
DENND2A (27147)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005249979.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000178923 CCAATGAAGGAGAACCCTTAT pLKO.1 1433 CDS 100% 10.800 7.560 N DENND2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005249979.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11848 pDONR223 100% 92.4% 91.4% None (many diffs) n/a
2 ccsbBroad304_11848 pLX_304 0% 92.4% 91.4% V5 (many diffs) n/a
3 TRCN0000478088 GCCCTCAGTTAAGATAATTGTCTA pLX_317 15.6% 92.4% 91.4% V5 (many diffs) n/a
Download CSV