Transcript: Human XM_005249994.3

PREDICTED: Homo sapiens Kell metallo-endopeptidase (Kell blood group) (KEL), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KEL (3792)
Length:
1718
CDS:
309..1580

Additional Resources:

NCBI RefSeq record:
XM_005249994.3
NBCI Gene record:
KEL (3792)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005249994.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432640 GGGACGTCAATGCTTACTATT pLKO_005 991 CDS 100% 13.200 18.480 N KEL n/a
2 TRCN0000047058 CCCGACAAGAATACAACGATA pLKO.1 853 CDS 100% 4.950 6.930 N KEL n/a
3 TRCN0000437723 CCAGCCTTTGCCAGGTATTTC pLKO_005 1506 CDS 100% 13.200 9.240 N KEL n/a
4 TRCN0000047060 GCCATTATGCTGCCTTTCCAT pLKO.1 1219 CDS 100% 3.000 2.100 N KEL n/a
5 TRCN0000047059 GCATACAGCAAGAGGCTGTTA pLKO.1 1323 CDS 100% 0.495 0.347 N KEL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005249994.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00906 pDONR223 100% 57.7% 57.7% None 0_1ins927 n/a
2 ccsbBroad304_00906 pLX_304 0% 57.7% 57.7% V5 0_1ins927 n/a
3 TRCN0000472034 TTAACGAAAAACTACGGATGGTGC pLX_317 19.7% 57.7% 57.7% V5 0_1ins927 n/a
Download CSV