Transcript: Human XM_005250143.3

PREDICTED: Homo sapiens SVOP like (SVOPL), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SVOPL (136306)
Length:
4804
CDS:
405..1883

Additional Resources:

NCBI RefSeq record:
XM_005250143.3
NBCI Gene record:
SVOPL (136306)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005250143.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158294 CCACGAAATACCGAGGCTATA pLKO.1 901 CDS 100% 10.800 15.120 N SVOPL n/a
2 TRCN0000153164 GCTGAGCCTTTCTATTACCAT pLKO.1 1517 CDS 100% 3.000 4.200 N SVOPL n/a
3 TRCN0000156499 CCGAGGCTATATGTTACCCTT pLKO.1 911 CDS 100% 2.640 3.696 N SVOPL n/a
4 TRCN0000152644 GCAGACCTATTGGATGCTAAA pLKO.1 1212 CDS 100% 10.800 7.560 N SVOPL n/a
5 TRCN0000153913 CCATCGGTGAAATTGCTTTGA pLKO.1 1456 CDS 100% 4.950 3.465 N SVOPL n/a
6 TRCN0000152614 GATCTCTTCCTTGAGGAACAA pLKO.1 2049 3UTR 100% 4.950 3.465 N SVOPL n/a
7 TRCN0000153331 GCTATGTCTACCAGATGAGAA pLKO.1 1895 3UTR 100% 4.950 3.465 N SVOPL n/a
8 TRCN0000152613 GCAAAGCTATGTCTACCAGAT pLKO.1 1890 3UTR 100% 4.050 2.835 N SVOPL n/a
9 TRCN0000157169 GTCTGTGTTGTATGCGCCATT pLKO.1 1806 CDS 100% 4.050 2.835 N SVOPL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005250143.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09566 pDONR223 100% 68.6% 68.1% None (many diffs) n/a
2 ccsbBroad304_09566 pLX_304 0% 68.6% 68.1% V5 (many diffs) n/a
3 TRCN0000475193 TTACGGATGTACCCATGTAAGGAC pLX_317 28.6% 68.6% 68.1% V5 (many diffs) n/a
Download CSV