Transcript: Human XM_005250311.3

PREDICTED: Homo sapiens killer cell lectin like receptor G2 (KLRG2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KLRG2 (346689)
Length:
1169
CDS:
75..1088

Additional Resources:

NCBI RefSeq record:
XM_005250311.3
NBCI Gene record:
KLRG2 (346689)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005250311.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244786 CGGCGAGGACAATCTGGATAT pLKO_005 1092 3UTR 100% 10.800 15.120 N KLRG2 n/a
2 TRCN0000154871 GCGAGGACAATCTGGATATCA pLKO.1 1094 3UTR 100% 5.625 7.875 N KLRG2 n/a
3 TRCN0000244784 GGCTACCCATGTACGTGAAGT pLKO_005 832 CDS 100% 4.950 6.930 N KLRG2 n/a
4 TRCN0000244785 ACAACCTGAAGGTCCCGAAAG pLKO_005 191 CDS 100% 6.000 4.800 N KLRG2 n/a
5 TRCN0000244783 TTGTCCGAGGAGCACTGTTAC pLKO_005 969 CDS 100% 10.800 7.560 N KLRG2 n/a
6 TRCN0000150494 GACAATCTGGATATCAACTGT pLKO.1 1099 3UTR 100% 3.000 2.100 N KLRG2 n/a
7 TRCN0000257002 CATGGAGCTGCAGGTAGATGT pLKO_005 437 CDS 100% 4.950 2.970 N KLRG2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005250311.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05505 pDONR223 100% 82.3% 81.9% None 1004_1005insG;1009C>T;1011_1012ins215 n/a
2 ccsbBroad304_05505 pLX_304 0% 82.3% 81.9% V5 1004_1005insG;1009C>T;1011_1012ins215 n/a
3 TRCN0000477831 ATACCTCGACAGGCTTTCCATGCA pLX_317 12.4% 82.3% 81.9% V5 1004_1005insG;1009C>T;1011_1012ins215 n/a
Download CSV