Transcript: Human XM_005250393.1

PREDICTED: Homo sapiens ATPase H+ transporting V0 subunit a4 (ATP6V0A4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATP6V0A4 (50617)
Length:
3483
CDS:
631..3153

Additional Resources:

NCBI RefSeq record:
XM_005250393.1
NBCI Gene record:
ATP6V0A4 (50617)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005250393.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000447978 AGATTTAATCACCGTCATAAC pLKO_005 1434 CDS 100% 10.800 15.120 N ATP6V0A4 n/a
2 TRCN0000451536 ATGACCACAGTGCAATCTAAA pLKO_005 1690 CDS 100% 13.200 9.240 N ATP6V0A4 n/a
3 TRCN0000038646 CCAAAGTTTCTTTGTGGTTAT pLKO.1 2547 CDS 100% 10.800 7.560 N ATP6V0A4 n/a
4 TRCN0000038645 CCCACATTTAACAGGACCAAT pLKO.1 1720 CDS 100% 4.950 3.465 N ATP6V0A4 n/a
5 TRCN0000038648 GCTCTGGACTATGGTGATGAA pLKO.1 2901 CDS 100% 4.950 3.465 N ATP6V0A4 n/a
6 TRCN0000038644 CCTGTGGATTTGATACGACTT pLKO.1 3300 3UTR 100% 4.050 2.835 N ATP6V0A4 n/a
7 TRCN0000038647 GCCTGCATATATGACCGGAAA pLKO.1 1116 CDS 100% 4.050 2.835 N ATP6V0A4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005250393.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08179 pDONR223 100% 99.9% 99.8% None 755C>G;1812T>C n/a
2 ccsbBroad304_08179 pLX_304 0% 99.9% 99.8% V5 755C>G;1812T>C n/a
3 TRCN0000466203 AGATCGAGCGTACGCGCATGTCTC pLX_317 15% 99.9% 99.8% V5 755C>G;1812T>C n/a
4 ccsbBroadEn_08180 pDONR223 100% 99.9% 99.8% None 755C>G;1662C>T n/a
5 ccsbBroad304_08180 pLX_304 0% 99.9% 99.8% V5 755C>G;1662C>T n/a
6 TRCN0000481441 GGCGGATGTTTAGCACCTCACCTT pLX_317 18.9% 99.9% 99.8% V5 755C>G;1662C>T n/a
Download CSV