Transcript: Human XM_005250453.1

PREDICTED: Homo sapiens paraoxonase 2 (PON2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PON2 (5445)
Length:
1584
CDS:
256..1116

Additional Resources:

NCBI RefSeq record:
XM_005250453.1
NBCI Gene record:
PON2 (5445)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005250453.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051647 GCTGCTCATAGGCACTTTATA pLKO.1 1068 CDS 100% 15.000 21.000 N PON2 n/a
2 TRCN0000051644 GCACTCAGAAATCGACTTAAA pLKO.1 144 5UTR 100% 13.200 18.480 N PON2 n/a
3 TRCN0000051643 GCACATTTCTATGCCACAAAT pLKO.1 574 CDS 100% 13.200 9.240 N PON2 n/a
4 TRCN0000291074 GCACATTTCTATGCCACAAAT pLKO_005 574 CDS 100% 13.200 9.240 N PON2 n/a
5 TRCN0000051645 CCACTACTTCTCTGATCCTTT pLKO.1 597 CDS 100% 4.950 3.465 N PON2 n/a
6 TRCN0000055029 CGACTTAAAGCCTCCAGAGAA pLKO.1 156 5UTR 100% 4.950 3.465 N Pon2 n/a
7 TRCN0000051646 GACTACAGTTTATGCCAACAA pLKO.1 999 CDS 100% 4.950 3.465 N PON2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005250453.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11045 pDONR223 100% 42.5% 39.2% None (many diffs) n/a
2 ccsbBroad304_11045 pLX_304 0% 42.5% 39.2% V5 (many diffs) n/a
3 TRCN0000467502 AGCTTCCAACACCTCCGAGACAGT pLX_317 71.3% 42.5% 39.2% V5 (many diffs) n/a
Download CSV