Transcript: Human XM_005251174.2

PREDICTED: Homo sapiens minichromosome maintenance domain containing 2 (MCMDC2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MCMDC2 (157777)
Length:
5124
CDS:
223..2079

Additional Resources:

NCBI RefSeq record:
XM_005251174.2
NBCI Gene record:
MCMDC2 (157777)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005251174.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149391 GCTTTATAGGAGACTTGGCTT pLKO.1 1256 CDS 100% 2.640 3.696 N MCMDC2 n/a
2 TRCN0000419296 CAAGTGATACTCTACTCATAG pLKO_005 1082 CDS 100% 10.800 8.640 N MCMDC2 n/a
3 TRCN0000413261 AGAATGACCCATGGCTATTAT pLKO_005 1711 CDS 100% 15.000 10.500 N MCMDC2 n/a
4 TRCN0000435285 CTAATTGCTAATGGGATAAAT pLKO_005 2234 3UTR 100% 15.000 10.500 N MCMDC2 n/a
5 TRCN0000147266 GCAGACTGAAACGCAAATTAA pLKO.1 303 CDS 100% 15.000 10.500 N MCMDC2 n/a
6 TRCN0000150099 CTCTGTTTGTTGATGAGTCTA pLKO.1 1003 CDS 100% 4.950 3.465 N MCMDC2 n/a
7 TRCN0000146420 CTGCCAAGTTATGGTCTTGAT pLKO.1 355 CDS 100% 4.950 3.465 N MCMDC2 n/a
8 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 3315 3UTR 100% 4.950 2.475 Y n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005251174.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13302 pDONR223 100% 77.7% 76.1% None (many diffs) n/a
2 ccsbBroad304_13302 pLX_304 0% 77.7% 76.1% V5 (many diffs) n/a
3 TRCN0000472583 ACAAATATGGCAACAGGTCCCGTA pLX_317 22.4% 77.7% 76.1% V5 (many diffs) n/a
Download CSV