Transcript: Human XM_005251440.5

PREDICTED: Homo sapiens beta-1,4-galactosyltransferase 1 (B4GALT1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
B4GALT1 (2683)
Length:
3914
CDS:
29..1102

Additional Resources:

NCBI RefSeq record:
XM_005251440.5
NBCI Gene record:
B4GALT1 (2683)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005251440.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303316 CCAGGCGGGAGACACTATATT pLKO_005 673 CDS 100% 15.000 21.000 N B4GALT1 n/a
2 TRCN0000303315 ATTGCTAAATTGTCGTGAAAT pLKO_005 1420 3UTR 100% 13.200 18.480 N B4GALT1 n/a
3 TRCN0000034840 CGTGCTAAGCTCCTCAATGTT pLKO.1 698 CDS 100% 5.625 7.875 N B4GALT1 n/a
4 TRCN0000034841 GCATGTCTATATCTCGCCCAA pLKO.1 879 CDS 100% 2.160 3.024 N B4GALT1 n/a
5 TRCN0000034842 CATTCCAATGAATGACCATAA pLKO.1 781 CDS 100% 1.080 1.512 N B4GALT1 n/a
6 TRCN0000303314 CCTCAAGTACTGGCTATATTA pLKO_005 598 CDS 100% 15.000 10.500 N B4GALT1 n/a
7 TRCN0000034843 GTGGCAAAGCAGAACCCAAAT pLKO.1 488 CDS 100% 10.800 7.560 N B4GALT1 n/a
8 TRCN0000307913 GTGGCAAAGCAGAACCCAAAT pLKO_005 488 CDS 100% 10.800 7.560 N B4GALT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005251440.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10847 pDONR223 100% 62.5% 60.7% None (many diffs) n/a
2 ccsbBroad304_10847 pLX_304 0% 62.5% 60.7% V5 (many diffs) n/a
3 TRCN0000476070 AAGGCTTCATCAGAGTCATGCACG pLX_317 42.1% 62.5% 60.7% V5 (many diffs) n/a
Download CSV