Transcript: Human XM_005251916.3

PREDICTED: Homo sapiens LIM homeobox 6 (LHX6), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LHX6 (26468)
Length:
923
CDS:
154..846

Additional Resources:

NCBI RefSeq record:
XM_005251916.3
NBCI Gene record:
LHX6 (26468)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005251916.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413472 CGAGATCCTGGACCGATATCT pLKO_005 465 CDS 100% 5.625 7.875 N LHX6 n/a
2 TRCN0000017138 CTACGACACCATGATTGAGAA pLKO.1 792 CDS 100% 4.950 3.465 N LHX6 n/a
3 TRCN0000017140 GATGGACTACTTCAGCCGATT pLKO.1 600 CDS 100% 4.050 2.835 N LHX6 n/a
4 TRCN0000017142 GCTGTCCACTGGTGAGGAGTT pLKO.1 735 CDS 100% 1.350 0.945 N LHX6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005251916.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11825 pDONR223 100% 51.1% 50.7% None (many diffs) n/a
2 ccsbBroad304_11825 pLX_304 0% 51.1% 50.7% V5 (many diffs) n/a
3 TRCN0000466117 CGATGCGGTCTTCATCTAAGGATC pLX_317 29.4% 51.1% 50.7% V5 (many diffs) n/a
Download CSV