Transcript: Human XM_005252152.1

PREDICTED: Homo sapiens TLE family member 1, transcriptional corepressor (TLE1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TLE1 (7088)
Length:
3166
CDS:
210..2651

Additional Resources:

NCBI RefSeq record:
XM_005252152.1
NBCI Gene record:
TLE1 (7088)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005252152.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330080 TCGGCAAGTTCCACTTCTTTG pLKO_005 1116 CDS 100% 10.800 15.120 N TLE1 n/a
2 TRCN0000019597 TCTGTGGATGATAAGTACATA pLKO.1 2580 CDS 100% 5.625 4.500 N TLE1 n/a
3 TRCN0000098008 GCAGTCTCACTTGGCAATAAA pLKO.1 758 CDS 100% 15.000 10.500 N Tle1 n/a
4 TRCN0000330155 GTCTGAACAGAGACAATTATA pLKO_005 1915 CDS 100% 15.000 10.500 N TLE1 n/a
5 TRCN0000019595 CGCAGAAATGGACCTGAATTT pLKO.1 879 CDS 100% 13.200 9.240 N TLE1 n/a
6 TRCN0000330078 CGCAGAAATGGACCTGAATTT pLKO_005 879 CDS 100% 13.200 9.240 N TLE1 n/a
7 TRCN0000330081 TATGTGGTTTAACGTTTATAG pLKO_005 2658 3UTR 100% 13.200 9.240 N TLE1 n/a
8 TRCN0000019598 CTACGCCAGTTTACACAACAT pLKO.1 1508 CDS 100% 4.950 3.465 N TLE1 n/a
9 TRCN0000019596 GATCTGCACAACCAGACACTA pLKO.1 2142 CDS 100% 4.950 3.465 N TLE1 n/a
10 TRCN0000330079 GATCTGCACAACCAGACACTA pLKO_005 2142 CDS 100% 4.950 3.465 N TLE1 n/a
11 TRCN0000019594 GCCTGCTAAAGAAGGATGCTT pLKO.1 1069 CDS 100% 3.000 2.100 N TLE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005252152.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01676 pDONR223 100% 94.6% 94.5% None 354A>G;373_402del;1094_1192del n/a
2 ccsbBroad304_01676 pLX_304 0% 94.6% 94.5% V5 354A>G;373_402del;1094_1192del n/a
3 TRCN0000472033 GTTGAGTAGATATGCCCGAGGGGC pLX_317 20.6% 94.6% 94.5% V5 354A>G;373_402del;1094_1192del n/a
4 ccsbBroadEn_07072 pDONR223 100% 94.6% 94.5% None (many diffs) n/a
5 ccsbBroad304_07072 pLX_304 0% 94.6% 94.5% V5 (many diffs) n/a
6 TRCN0000470715 GCATCAGATGATGCAAGGCGTTCG pLX_317 14.3% 94.6% 94.5% V5 (many diffs) n/a
7 ccsbBroadEn_11192 pDONR223 100% 69.5% 74.2% None (many diffs) n/a
8 ccsbBroad304_11192 pLX_304 0% 69.5% 74.2% V5 (many diffs) n/a
Download CSV