Transcript: Human XM_005252435.3

PREDICTED: Homo sapiens La ribonucleoprotein 4B (LARP4B), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LARP4B (23185)
Length:
2635
CDS:
480..2432

Additional Resources:

NCBI RefSeq record:
XM_005252435.3
NBCI Gene record:
LARP4B (23185)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005252435.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121550 CAGGCTATCTAGCTTGATAAT pLKO.1 1766 CDS 100% 13.200 18.480 N LARP4B n/a
2 TRCN0000427508 CGAAGCAGGAATCCTAGTAAA pLKO_005 1335 CDS 100% 13.200 18.480 N LARP4B n/a
3 TRCN0000139604 CCAGCTCATTTACCCGATGAT pLKO.1 1914 CDS 100% 4.950 6.930 N LARP4B n/a
4 TRCN0000122023 GCATAGTAATATTGCGTGAAA pLKO.1 817 CDS 100% 4.950 6.930 N LARP4B n/a
5 TRCN0000122708 CGAGTAAAGAGCCTCCTTCTT pLKO.1 2185 CDS 100% 4.950 3.960 N LARP4B n/a
6 TRCN0000421566 AGCAAAGGCAATAGCTATAAA pLKO_005 1037 CDS 100% 15.000 10.500 N LARP4B n/a
7 TRCN0000216171 CATCTGATGAATGGTCCTATA pLKO.1 115 5UTR 100% 10.800 7.560 N Larp4b n/a
8 TRCN0000144706 GATTTGTCAGAGAACGAGTAA pLKO.1 2171 CDS 100% 4.950 3.465 N LARP4B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005252435.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02731 pDONR223 100% 79.5% 79.5% None 0_1ins369;1560_1664del n/a
2 ccsbBroad304_02731 pLX_304 0% 79.5% 79.5% V5 0_1ins369;1560_1664del n/a
3 TRCN0000473978 GACTACGACTAAGTGGCATACCGC pLX_317 15.6% 79.5% 79.5% V5 0_1ins369;1560_1664del n/a
Download CSV