Transcript: Human XM_005252475.4

PREDICTED: Homo sapiens transcription activation suppressor family member 2 (TASOR2), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TASOR2 (54906)
Length:
9095
CDS:
1098..8390

Additional Resources:

NCBI RefSeq record:
XM_005252475.4
NBCI Gene record:
TASOR2 (54906)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005252475.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000268861 TGTTAGCCGATCTAGCATTAA pLKO_005 2704 CDS 100% 13.200 18.480 N TASOR2 n/a
2 TRCN0000268863 CCATTGAGTCCAGCGTCAAAT pLKO_005 2109 CDS 100% 13.200 9.240 N TASOR2 n/a
3 TRCN0000268860 TATGACTCCCAGGCCCTAAAT pLKO_005 2682 CDS 100% 13.200 9.240 N TASOR2 n/a
4 TRCN0000268859 CTGCCGAAATGCCTCTAATAT pLKO_005 5524 CDS 100% 15.000 9.000 N TASOR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005252475.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14176 pDONR223 100% 30.4% 30.4% None 1_5067del;7211G>A;7286A>C n/a
2 ccsbBroad304_14176 pLX_304 0% 30.4% 30.4% V5 1_5067del;7211G>A;7286A>C n/a
3 TRCN0000467616 AACCAAATCAATTGACATCTCTCA pLX_317 21.6% 30.4% 30.4% V5 1_5067del;7211G>A;7286A>C n/a
Download CSV