Transcript: Human XM_005253196.3

PREDICTED: Homo sapiens MAP kinase activating death domain (MADD), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MADD (8567)
Length:
5923
CDS:
216..5042

Additional Resources:

NCBI RefSeq record:
XM_005253196.3
NBCI Gene record:
MADD (8567)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005253196.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232433 GAAATCTGCTACTCCGTATTA pLKO_005 4944 CDS 100% 13.200 18.480 N MADD n/a
2 TRCN0000232434 GCCGGTGTGAACCCACTATTT pLKO_005 5298 3UTR 100% 13.200 18.480 N MADD n/a
3 TRCN0000232430 TCGATTCACCCTAGTGGATTT pLKO_005 1079 CDS 100% 10.800 15.120 N MADD n/a
4 TRCN0000232431 ATCTACCCACTGGAGTATATG pLKO_005 1242 CDS 100% 13.200 10.560 N MADD n/a
5 TRCN0000037882 GCGAATCTATGACAATCCATA pLKO.1 2510 CDS 100% 4.950 3.960 N MADD n/a
6 TRCN0000037879 CCATCCTCAATCTGGAGAAAT pLKO.1 1537 CDS 100% 13.200 9.240 N MADD n/a
7 TRCN0000232432 TTGCCCAGACCCACTACTATA pLKO_005 3343 CDS 100% 13.200 9.240 N MADD n/a
8 TRCN0000362801 TTGCCCAGACCCACTACTATA pLKO_005 3343 CDS 100% 13.200 9.240 N Madd n/a
9 TRCN0000037880 GCTCAACAAGTTCTATACTAA pLKO.1 4616 CDS 100% 5.625 3.938 N MADD n/a
10 TRCN0000037883 CCACAAGTACAAGACACCAAT pLKO.1 4916 CDS 100% 4.950 3.465 N MADD n/a
11 TRCN0000037881 CCAGGAAATGATCGACAGGTA pLKO.1 4133 CDS 100% 2.640 1.848 N MADD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005253196.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07265 pDONR223 100% 95.8% 95.8% None (many diffs) n/a
2 ccsbBroad304_07265 pLX_304 0% 95.8% 95.8% V5 (many diffs) n/a
3 TRCN0000470759 TACTATCTTTCACCGCGTTTTGTG pLX_317 10.2% 95.8% 95.8% V5 (many diffs) n/a
Download CSV