Transcript: Human XM_005253351.3

PREDICTED: Homo sapiens glutamate ionotropic receptor NMDA type subunit 2B (GRIN2B), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GRIN2B (2904)
Length:
27807
CDS:
121..2361

Additional Resources:

NCBI RefSeq record:
XM_005253351.3
NBCI Gene record:
GRIN2B (2904)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005253351.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425036 GCAGCAGTGCTGAACTATATG pLKO_005 103 5UTR 100% 13.200 9.240 N GRIN2B n/a
2 TRCN0000063529 GCTATGGCATTGCCATCCAAA pLKO.1 188 CDS 100% 4.950 3.465 N GRIN2B n/a
3 TRCN0000063531 CCGATGTCTCTGACATCTCAA pLKO.1 1079 CDS 100% 0.495 0.347 N GRIN2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005253351.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000476032 CAGCTATCTCGCAGTATGCAGTTT pLX_317 8.5% 50.1% V5 (not translated due to prior stop codon) 0_1ins2214;1252_1254delAAGinsCCA;1320C>T n/a
Download CSV