Transcript: Human XM_005253622.3

PREDICTED: Homo sapiens VPS37B subunit of ESCRT-I (VPS37B), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VPS37B (79720)
Length:
5462
CDS:
2903..3676

Additional Resources:

NCBI RefSeq record:
XM_005253622.3
NBCI Gene record:
VPS37B (79720)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005253622.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140011 GCCGATGAAGTGGATGCAATT pLKO.1 4538 3UTR 100% 10.800 8.640 N VPS37B n/a
2 TRCN0000380091 AGCATGGTTCATGATACTTAT pLKO_005 4028 3UTR 100% 13.200 9.240 N VPS37B n/a
3 TRCN0000122091 CAGAATGTTCAGCTTAACAAA pLKO.1 2933 CDS 100% 5.625 3.938 N VPS37B n/a
4 TRCN0000144349 CCTGAAGGTTTCTATGAAGAA pLKO.1 4387 3UTR 100% 4.950 3.465 N VPS37B n/a
5 TRCN0000140578 GAGACCCTGTTAGCACTTCTT pLKO.1 3128 CDS 100% 4.950 3.465 N VPS37B n/a
6 TRCN0000141850 GATTGAGGAAGACACTGAGAA pLKO.1 3166 CDS 100% 4.950 3.465 N VPS37B n/a
7 TRCN0000139237 CCAGGTTCTCTTTGAAGCCTA pLKO.1 3058 CDS 100% 2.640 1.848 N VPS37B n/a
8 TRCN0000145312 CCTATCAGATAAAGAAGACCA pLKO.1 3075 CDS 100% 2.640 1.848 N VPS37B n/a
9 TRCN0000140271 GCAGATCGAAATGCCGATGAA pLKO.1 4526 3UTR 100% 4.950 2.970 N VPS37B n/a
10 TRCN0000140411 GAAGACACTGAGAACATGGCA pLKO.1 3173 CDS 100% 0.750 0.450 N VPS37B n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 21 5UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 21 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005253622.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04113 pDONR223 100% 88.4% 85.5% None (many diffs) n/a
2 ccsbBroad304_04113 pLX_304 0% 88.4% 85.5% V5 (many diffs) n/a
3 TRCN0000467771 ATTGCGTGCCCTTACATCGGAGCG pLX_317 2.1% 88.4% 85.5% V5 (many diffs) n/a
Download CSV