Transcript: Human XM_005253814.4

PREDICTED: Homo sapiens CD9 molecule (CD9), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CD9 (928)
Length:
1399
CDS:
116..865

Additional Resources:

NCBI RefSeq record:
XM_005253814.4
NBCI Gene record:
CD9 (928)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005253814.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296952 CACAAGGATGAGGTGATTAAG pLKO_005 452 CDS 100% 13.200 18.480 N CD9 n/a
2 TRCN0000380009 CAAGAAGGACGTACTCGAAAC pLKO_005 767 CDS 100% 6.000 8.400 N CD9 n/a
3 TRCN0000057470 GCTGTTCGGATTTAACTTCAT pLKO.1 154 CDS 100% 4.950 6.930 N CD9 n/a
4 TRCN0000291711 GCTGTTCGGATTTAACTTCAT pLKO_005 154 CDS 100% 4.950 6.930 N CD9 n/a
5 TRCN0000057469 CATTGGACTATGGCTCCGATT pLKO.1 205 CDS 100% 4.050 5.670 N CD9 n/a
6 TRCN0000296954 CTTCGAGCAAGAAACTAATAA pLKO_005 247 CDS 100% 15.000 12.000 N CD9 n/a
7 TRCN0000296953 TTCTACACAGGAGTCTATATT pLKO_005 281 CDS 100% 15.000 10.500 N CD9 n/a
8 TRCN0000348368 CCACAAGGATGAGGTGATTAA pLKO_005 451 CDS 100% 13.200 9.240 N Cd9 n/a
9 TRCN0000066394 CCCACAAGGATGAGGTGATTA pLKO.1 450 CDS 100% 13.200 9.240 N Cd9 n/a
10 TRCN0000057471 CGGCTTCCTCTTGGTGATATT pLKO.1 394 CDS 100% 13.200 9.240 N CD9 n/a
11 TRCN0000380058 TGTCCTTGCCATTGGACTATG pLKO_005 196 CDS 100% 10.800 7.560 N CD9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005253814.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05957 pDONR223 100% 68.3% 58.5% None (many diffs) n/a
2 ccsbBroad304_05957 pLX_304 0% 68.3% 58.5% V5 (many diffs) n/a
3 TRCN0000466115 GAACGAAATCACACAGCTCGGCAC pLX_317 62.5% 68.3% 58.5% V5 (many diffs) n/a
Download CSV