Transcript: Human XM_005253889.4

PREDICTED: Homo sapiens 2'-5'-oligoadenylate synthetase 3 (OAS3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OAS3 (4940)
Length:
6616
CDS:
69..3338

Additional Resources:

NCBI RefSeq record:
XM_005253889.4
NBCI Gene record:
OAS3 (4940)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005253889.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000320372 GGTGAACAAGGCCGTTGATAC pLKO_005 2384 CDS 100% 10.800 15.120 N OAS3 n/a
2 TRCN0000005014 CGTTGATACCATCTGTTCATT pLKO.1 2396 CDS 100% 5.625 4.500 N OAS3 n/a
3 TRCN0000005016 CCAAGCCACAAGTCTACTCTA pLKO.1 553 CDS 100% 4.950 3.960 N OAS3 n/a
4 TRCN0000005015 GCCATGAGAATGCACCTTCTT pLKO.1 2112 CDS 100% 4.950 3.960 N OAS3 n/a
5 TRCN0000320373 TCTACTGGACGGTCAACTATA pLKO_005 2077 CDS 100% 13.200 9.240 N OAS3 n/a
6 TRCN0000320371 GAAGAGCTGGACGGATGTTAG pLKO_005 1679 CDS 100% 10.800 7.560 N OAS3 n/a
7 TRCN0000320444 GGCAGTTCGAGGTCAAGTTTG pLKO_005 2629 CDS 100% 10.800 7.560 N OAS3 n/a
8 TRCN0000005013 CGGAGGAACTTTGTGAACATT pLKO.1 630 CDS 100% 5.625 3.938 N OAS3 n/a
9 TRCN0000320370 CGGAGGAACTTTGTGAACATT pLKO_005 630 CDS 100% 5.625 3.938 N OAS3 n/a
10 TRCN0000005012 CCCATGCAAATTAGCTCACAT pLKO.1 3686 3UTR 100% 4.950 3.465 N OAS3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005253889.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.