Transcript: Human XM_005253984.1

PREDICTED: Homo sapiens ankyrin repeat domain 13A (ANKRD13A), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANKRD13A (88455)
Length:
3709
CDS:
320..1831

Additional Resources:

NCBI RefSeq record:
XM_005253984.1
NBCI Gene record:
ANKRD13A (88455)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005253984.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167995 CGAGTCTTACTCCGACATAAA pLKO.1 227 5UTR 100% 13.200 18.480 N ANKRD13A n/a
2 TRCN0000431140 GAGCATCATCACTTTCCATTA pLKO_005 2066 3UTR 100% 10.800 8.640 N ANKRD13A n/a
3 TRCN0000167684 GCACGGATTACATTTGGAAAT pLKO.1 1319 CDS 100% 10.800 8.640 N ANKRD13A n/a
4 TRCN0000168369 GCCGAAGAATCTGTATCTCAA pLKO.1 1358 CDS 100% 4.950 3.960 N ANKRD13A n/a
5 TRCN0000420513 CATTCCCATCATTGACCTAAT pLKO_005 1192 CDS 100% 10.800 7.560 N ANKRD13A n/a
6 TRCN0000167374 GATATCACATTGCTGGGATTT pLKO.1 527 CDS 100% 10.800 7.560 N ANKRD13A n/a
7 TRCN0000168122 GCTGACGATTAGAACACAGAA pLKO.1 1114 CDS 100% 4.950 3.465 N ANKRD13A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005253984.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12919 pDONR223 100% 27.5% 27.2% None (many diffs) n/a
2 ccsbBroad304_12919 pLX_304 0% 27.5% 27.2% V5 (many diffs) n/a
3 TRCN0000468810 TCGCTGGAGGCTTTATGGGGCCGT pLX_317 50.8% 27.5% 27.2% V5 (many diffs) n/a
Download CSV