Transcript: Human XM_005254434.4

PREDICTED: Homo sapiens RAS like family 12 (RASL12), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RASL12 (51285)
Length:
681
CDS:
88..543

Additional Resources:

NCBI RefSeq record:
XM_005254434.4
NBCI Gene record:
RASL12 (51285)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005254434.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072989 GACCGTGAAGTTTCTGACCAA pLKO.1 195 CDS 100% 2.640 3.696 N RASL12 n/a
2 TRCN0000072990 GTTTCTGACCAAGAGGTTTAT pLKO.1 204 CDS 100% 13.200 9.240 N RASL12 n/a
3 TRCN0000072992 CAAGAGGTTTATCAGTGAATA pLKO.1 213 CDS 100% 13.200 7.920 N RASL12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005254434.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08272 pDONR223 100% 54.3% 54.5% None (many diffs) n/a
2 ccsbBroad304_08272 pLX_304 0% 54.3% 54.5% V5 (many diffs) n/a
3 TRCN0000470447 AATGCACCAAATTCCTAAGTCAGC pLX_317 55.9% 54.3% 54.5% V5 (many diffs) n/a
Download CSV