Transcript: Human XM_005254441.2

PREDICTED: Homo sapiens CTD small phosphatase like 2 (CTDSPL2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CTDSPL2 (51496)
Length:
5112
CDS:
112..1512

Additional Resources:

NCBI RefSeq record:
XM_005254441.2
NBCI Gene record:
CTDSPL2 (51496)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005254441.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160759 CGGAGTAGAATTGAACGTGAT pLKO.1 322 CDS 100% 4.050 5.670 N CTDSPL2 n/a
2 TRCN0000158685 GCACACAGATTTAATGGATAA pLKO.1 2352 3UTR 100% 10.800 8.640 N CTDSPL2 n/a
3 TRCN0000216375 GTGTACAAGGAAACTATATAA pLKO.1 1253 CDS 100% 15.000 10.500 N Ctdspl2 n/a
4 TRCN0000159129 GCTCTCAGTTACAATCAATTT pLKO.1 2543 3UTR 100% 13.200 9.240 N CTDSPL2 n/a
5 TRCN0000160016 CTTTCTAATGGAATCCCTATA pLKO.1 1351 CDS 100% 10.800 7.560 N CTDSPL2 n/a
6 TRCN0000164548 CCTGGAACGAATGTCTCAGAT pLKO.1 1116 CDS 100% 4.950 3.465 N CTDSPL2 n/a
7 TRCN0000137355 GAAGAATGAAACCGGCTTGTT pLKO.1 237 CDS 100% 4.950 3.465 N CTDSPL2 n/a
8 TRCN0000158961 GCTTACTCAAATCAAGCAGTT pLKO.1 706 CDS 100% 4.050 2.835 N CTDSPL2 n/a
9 TRCN0000134621 GCTTTCTAATGGAATCCCTAT pLKO.1 1350 CDS 100% 4.050 2.835 N CTDSPL2 n/a
10 TRCN0000136623 GCTTCTAAGAAGGTGTATGCA pLKO.1 1159 CDS 100% 3.000 2.100 N CTDSPL2 n/a
11 TRCN0000174334 CAGATGTATGAGATCATTCTT pLKO.1 1132 CDS 100% 5.625 3.375 N Ctdspl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005254441.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.