Transcript: Human XM_005255041.2

PREDICTED: Homo sapiens mitochondrial ribosomal protein L28 (MRPL28), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MRPL28 (10573)
Length:
1128
CDS:
67..837

Additional Resources:

NCBI RefSeq record:
XM_005255041.2
NBCI Gene record:
MRPL28 (10573)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005255041.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163416 GCCATTGAGAAGCAGAGACTT pLKO.1 697 CDS 100% 4.950 3.465 N MRPL28 n/a
2 TRCN0000344215 GCCATTGAGAAGCAGAGACTT pLKO_005 697 CDS 100% 4.950 3.465 N MRPL28 n/a
3 TRCN0000164349 CAAGTTTGGGATGGACCTGAA pLKO.1 531 CDS 100% 4.050 2.835 N MRPL28 n/a
4 TRCN0000344213 CAAGTTTGGGATGGACCTGAA pLKO_005 531 CDS 100% 4.050 2.835 N MRPL28 n/a
5 TRCN0000161170 CAAGAAGTTCACAGTGACTGT pLKO.1 426 CDS 100% 2.640 1.848 N MRPL28 n/a
6 TRCN0000344212 CAAGAAGTTCACAGTGACTGT pLKO_005 426 CDS 100% 2.640 1.848 N MRPL28 n/a
7 TRCN0000164129 CAAGGAATTTGCCATCCCAGA pLKO.1 639 CDS 100% 2.160 1.512 N MRPL28 n/a
8 TRCN0000344292 CAAGGAATTTGCCATCCCAGA pLKO_005 639 CDS 100% 2.160 1.512 N MRPL28 n/a
9 TRCN0000163415 GAGGCTGAAGAAAGTGTGGAA pLKO.1 363 CDS 100% 2.640 1.584 N MRPL28 n/a
10 TRCN0000344289 GAGGCTGAAGAAAGTGTGGAA pLKO_005 363 CDS 100% 2.640 1.584 N MRPL28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005255041.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07640 pDONR223 100% 99.8% 100% None 417T>C n/a
2 ccsbBroad304_07640 pLX_304 0% 99.8% 100% V5 417T>C n/a
3 TRCN0000491768 TCCCGATGAGGGCGGCGAGCAATA pLX_317 43.9% 99.8% 100% V5 417T>C n/a
4 ccsbBroadEn_07639 pDONR223 100% 99.6% 99.6% None 79C>T;355C>T;417T>C n/a
5 ccsbBroad304_07639 pLX_304 0% 99.6% 99.6% V5 79C>T;355C>T;417T>C n/a
6 TRCN0000471749 GACGAGTTCGGAAGAATGCTCCCA pLX_317 65.7% 99.6% 99.6% V5 79C>T;355C>T;417T>C n/a
Download CSV