Transcript: Human XM_005255226.2

PREDICTED: Homo sapiens serine/arginine repetitive matrix 2 (SRRM2), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SRRM2 (23524)
Length:
10776
CDS:
1976..10231

Additional Resources:

NCBI RefSeq record:
XM_005255226.2
NBCI Gene record:
SRRM2 (23524)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005255226.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314504 GTTGGGACTGGAGGTTGTATA pLKO_005 10582 3UTR 100% 13.200 18.480 N SRRM2 n/a
2 TRCN0000000176 CGCCACCTAAACAGAAATCTA pLKO.1 4437 CDS 100% 5.625 7.875 N SRRM2 n/a
3 TRCN0000130685 CGCCACCTAAACAGAAATCTA pLKO.1 4437 CDS 100% 5.625 7.875 N SRRM2 n/a
4 TRCN0000314502 CGCCACCTAAACAGAAATCTA pLKO_005 4437 CDS 100% 5.625 7.875 N SRRM2 n/a
5 TRCN0000127614 CCGTTTCTTAATCAGCTGGAA pLKO.1 6047 CDS 100% 2.640 3.696 N SRRM2 n/a
6 TRCN0000350298 CCGTTTCTTAATCAGCTGGAA pLKO_005 6047 CDS 100% 2.640 3.696 N SRRM2 n/a
7 TRCN0000000177 CCCAAAGTGAAGGCAATAATA pLKO.1 4724 CDS 100% 15.000 10.500 N SRRM2 n/a
8 TRCN0000314562 CCCAAAGTGAAGGCAATAATA pLKO_005 4724 CDS 100% 15.000 10.500 N SRRM2 n/a
9 TRCN0000130209 CCCAACCTAAAGCTAAATCTA pLKO.1 4380 CDS 100% 5.625 3.938 N SRRM2 n/a
10 TRCN0000130672 CATCTCCAGTAACTCGAAGAA pLKO.1 7968 CDS 100% 4.950 3.465 N SRRM2 n/a
11 TRCN0000128070 GCTGTGTCTTTGACTCTTGAT pLKO.1 5810 CDS 100% 4.950 3.465 N SRRM2 n/a
12 TRCN0000000175 CTGGAGGTTGTATAAGGTGTT pLKO.1 10589 3UTR 100% 4.050 2.835 N SRRM2 n/a
13 TRCN0000000178 GAAGAGTTAATGGAGGTGGTA pLKO.1 5681 CDS 100% 2.640 1.848 N SRRM2 n/a
14 TRCN0000130321 GCCCTTATGAAGACAAAGATA pLKO.1 2973 CDS 100% 5.625 3.375 N SRRM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005255226.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.