Transcript: Human XM_005255233.5

PREDICTED: Homo sapiens FUS RNA binding protein (FUS), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FUS (2521)
Length:
1770
CDS:
638..1603

Additional Resources:

NCBI RefSeq record:
XM_005255233.5
NBCI Gene record:
FUS (2521)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005255233.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001132 CGGACTATGTAATTGTAACTA pLKO.1 1711 3UTR 100% 5.625 7.875 N FUS n/a
2 TRCN0000221582 CGAACAGGATAATTCAGACAA pLKO.1 853 CDS 100% 4.950 6.930 N FUS n/a
3 TRCN0000001133 GCCTGGGTGAGAATGTTACAA pLKO.1 894 CDS 100% 5.625 4.500 N FUS n/a
4 TRCN0000001135 ACAGGATAATTCAGACAACAA pLKO.1 856 CDS 100% 4.950 3.960 N FUS n/a
5 TRCN0000221580 CCAGAGCAGCTATTCTTCTTA pLKO.1 213 5UTR 100% 5.625 3.938 N FUS n/a
6 TRCN0000288705 CCAGAGCAGCTATTCTTCTTA pLKO_005 213 5UTR 100% 5.625 3.938 N FUS n/a
7 TRCN0000221581 CCTGGGTGAGAATGTTACAAT pLKO.1 895 CDS 100% 5.625 3.938 N FUS n/a
8 TRCN0000221579 GCTGATTACTTCAAGCAGATT pLKO.1 926 CDS 100% 4.950 3.465 N FUS n/a
9 TRCN0000288639 GCTGATTACTTCAAGCAGATT pLKO_005 926 CDS 100% 4.950 3.465 N FUS n/a
10 TRCN0000010598 TCGCAGGGAGAGGCCGTATTA pLKO.1 1582 CDS 100% 4.400 3.080 N FUS n/a
11 TRCN0000010450 ATGAATGCAACCAGTGTAAGG pLKO.1 1347 CDS 100% 4.050 2.835 N FUS n/a
12 TRCN0000295857 ATGAATGCAACCAGTGTAAGG pLKO_005 1347 CDS 100% 4.050 2.835 N FUS n/a
13 TRCN0000010451 ATTCCTGATCACCCAAGGGTT pLKO.1 1681 3UTR 100% 2.640 1.848 N FUS n/a
14 TRCN0000221578 TTCCTGATCACCCAAGGGTTC pLKO.1 1682 3UTR 100% 2.160 1.512 N FUS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005255233.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06229 pDONR223 99.3% 61% 45.8% None 0_1ins580;183_184ins35 n/a
2 ccsbBroad304_06229 pLX_304 0% 61% 45.8% V5 (not translated due to prior stop codon) 0_1ins580;183_184ins35 n/a
Download CSV