Transcript: Human XM_005255498.2

PREDICTED: Homo sapiens rhomboid 5 homolog 1 (RHBDF1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RHBDF1 (64285)
Length:
2847
CDS:
947..2566

Additional Resources:

NCBI RefSeq record:
XM_005255498.2
NBCI Gene record:
RHBDF1 (64285)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005255498.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048669 GATTGACAACTTTGCCCACAT pLKO.1 2296 CDS 100% 4.050 5.670 N RHBDF1 n/a
2 TRCN0000420857 GAAACGCTGCCAGATCATCAT pLKO_005 2395 CDS 100% 4.950 3.960 N RHBDF1 n/a
3 TRCN0000413823 GGGTCTACGAGAACGTCAAGT pLKO_005 1335 CDS 100% 4.950 3.960 N RHBDF1 n/a
4 TRCN0000420959 CAGTGACAGCACCCAGAAATG pLKO_005 284 5UTR 100% 10.800 7.560 N RHBDF1 n/a
5 TRCN0000412691 TATACTACTTCCTGTCATAAC pLKO_005 2750 3UTR 100% 10.800 7.560 N RHBDF1 n/a
6 TRCN0000048671 CTGGGCATGCAGAAGATCATA pLKO.1 450 5UTR 100% 5.625 3.938 N RHBDF1 n/a
7 TRCN0000048672 GAGCTGGACACATCCTTCTTT pLKO.1 771 5UTR 100% 5.625 3.938 N RHBDF1 n/a
8 TRCN0000048670 GCGCATCGACAGCTTCGTCAA pLKO.1 1156 CDS 100% 1.350 0.945 N RHBDF1 n/a
9 TRCN0000305057 TGGGCATGCAGAAGATCATAG pLKO_005 451 5UTR 100% 10.800 6.480 N Rhbdf1 n/a
10 TRCN0000048668 CTTTGGCAAGTTCGACCTGTA pLKO.1 2371 CDS 100% 4.050 2.430 N RHBDF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005255498.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08850 pDONR223 100% 63% 63% None 0_1ins948;1374A>G n/a
2 ccsbBroad304_08850 pLX_304 0% 63% 63% V5 0_1ins948;1374A>G n/a
3 TRCN0000477551 TGGGAGGTTGGTTGCGCTCGGTCT pLX_317 11.3% 63% 63% V5 0_1ins948;1374A>G n/a
Download CSV