Transcript: Human XM_005256190.1

PREDICTED: Homo sapiens cysteine rich secretory protein LCCL domain containing 2 (CRISPLD2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CRISPLD2 (83716)
Length:
4844
CDS:
483..1976

Additional Resources:

NCBI RefSeq record:
XM_005256190.1
NBCI Gene record:
CRISPLD2 (83716)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005256190.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371910 ACCACAAGGCGAAGATCTTTG pLKO_005 1423 CDS 100% 10.800 8.640 N CRISPLD2 n/a
2 TRCN0000371851 TCTACTTTGTCTGCAATTATT pLKO_005 1063 CDS 100% 15.000 10.500 N CRISPLD2 n/a
3 TRCN0000377766 GACGTGATGCCCGTGGATAAA pLKO_005 1854 CDS 100% 13.200 9.240 N CRISPLD2 n/a
4 TRCN0000371912 ATGAAAGCTCGTCTAGCATAT pLKO_005 1456 CDS 100% 10.800 7.560 N CRISPLD2 n/a
5 TRCN0000152150 CCAATGAGTTTCAGGAATGAA pLKO.1 2410 3UTR 100% 5.625 3.938 N CRISPLD2 n/a
6 TRCN0000156030 CCAGCTCATTCATGGTGTCAA pLKO.1 1609 CDS 100% 4.950 3.465 N CRISPLD2 n/a
7 TRCN0000195759 CGTCAGATGTGACACCAAGAT pLKO.1 1343 CDS 100% 4.950 3.465 N CRISPLD2 n/a
8 TRCN0000156124 CCGCAGTTTATGTGTGTGCTT pLKO.1 4626 3UTR 100% 2.640 1.848 N CRISPLD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005256190.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12752 pDONR223 100% 89.2% 85.9% None (many diffs) n/a
2 ccsbBroad304_12752 pLX_304 0% 89.2% 85.9% V5 (many diffs) n/a
Download CSV