Transcript: Human XM_005256226.3

PREDICTED: Homo sapiens TATA-box binding protein associated factor, RNA polymerase I subunit C (TAF1C), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TAF1C (9013)
Length:
3864
CDS:
166..2775

Additional Resources:

NCBI RefSeq record:
XM_005256226.3
NBCI Gene record:
TAF1C (9013)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005256226.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013324 GCCGTGTGGAAGTTTGGTAAA pLKO.1 1114 CDS 100% 10.800 15.120 N TAF1C n/a
2 TRCN0000423863 TGATGATGAGCCAAGCAATTT pLKO_005 2895 3UTR 100% 13.200 9.240 N TAF1C n/a
3 TRCN0000418187 ACGTCCCTGACCTCTCTTTCA pLKO_005 227 CDS 100% 4.950 3.465 N TAF1C n/a
4 TRCN0000013325 CTACTCTTCATCTCGTCTGTA pLKO.1 1526 CDS 100% 4.950 3.465 N TAF1C n/a
5 TRCN0000013323 CTGATGACATAGTAAGAGAAA pLKO.1 3694 3UTR 100% 4.950 3.465 N TAF1C n/a
6 TRCN0000413828 GCAGATGCTCCGTGACTACAT pLKO_005 2601 CDS 100% 4.950 3.465 N TAF1C n/a
7 TRCN0000421618 TGGATGTGACTGAGCAGATCA pLKO_005 467 CDS 100% 4.950 3.465 N TAF1C n/a
8 TRCN0000013326 AGGGAGAAAGTAAGGCCCTTA pLKO.1 995 CDS 100% 4.050 2.835 N TAF1C n/a
9 TRCN0000416320 GCATTTCCAAGAGGTCGTTCT pLKO_005 885 CDS 100% 4.050 2.835 N TAF1C n/a
10 TRCN0000013327 CTCTTGGATCATGGAGACGTA pLKO.1 496 CDS 100% 2.640 1.848 N TAF1C n/a
11 TRCN0000426694 GTGAAGATGCTGGACACTCAG pLKO_005 1387 CDS 100% 4.050 2.430 N TAF1C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005256226.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07336 pDONR223 100% 88.9% 88.8% None (many diffs) n/a
2 ccsbBroad304_07336 pLX_304 0% 88.9% 88.8% V5 (many diffs) n/a
3 TRCN0000470147 AACCGAGCGATGCGCTATAGTTGC pLX_317 6.4% 88.9% 88.8% V5 (many diffs) n/a
Download CSV