Transcript: Human XM_005256424.2

PREDICTED: Homo sapiens kinesin family member 1C (KIF1C), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIF1C (10749)
Length:
5165
CDS:
349..3660

Additional Resources:

NCBI RefSeq record:
XM_005256424.2
NBCI Gene record:
KIF1C (10749)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005256424.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430725 AGTGAGGGTTCGGCCCTTTAA pLKO_005 375 CDS 100% 13.200 18.480 N KIF1C n/a
2 TRCN0000116590 CCTCATGGACTGTGGAAATAA pLKO.1 930 CDS 100% 15.000 10.500 N KIF1C n/a
3 TRCN0000313837 TTCCAGGCCTCCTGCTATATT pLKO_005 4120 3UTR 100% 15.000 10.500 N Kif1c n/a
4 TRCN0000431476 GCAGCAAGGCATCGACATAAA pLKO_005 2247 CDS 100% 13.200 9.240 N KIF1C n/a
5 TRCN0000423328 GACTCGGAGAAGGTCAGTAAG pLKO_005 1057 CDS 100% 10.800 7.560 N KIF1C n/a
6 TRCN0000116591 CCAAGTAGATATGGACATCAA pLKO.1 1926 CDS 100% 4.950 3.465 N KIF1C n/a
7 TRCN0000116587 CCAGGAGCAAACCAAAGTGAA pLKO.1 3850 3UTR 100% 4.950 3.465 N KIF1C n/a
8 TRCN0000116589 CTGGAGAATCAGTACCGGAAA pLKO.1 2296 CDS 100% 4.050 2.835 N KIF1C n/a
9 TRCN0000116588 CCTTGCAGATATGCAATCAAA pLKO.1 1200 CDS 100% 0.563 0.394 N KIF1C n/a
10 TRCN0000429854 TGAGCCCTGCTGACATCAATT pLKO_005 1322 CDS 100% 13.200 7.920 N KIF1C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005256424.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02519 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02519 pLX_304 0% 100% 100% V5 n/a
Download CSV