Transcript: Human XM_005256990.3

PREDICTED: Homo sapiens CD300a molecule (CD300A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CD300A (11314)
Length:
1521
CDS:
60..851

Additional Resources:

NCBI RefSeq record:
XM_005256990.3
NBCI Gene record:
CD300A (11314)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005256990.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163887 CCCAGGGAAGAACTTCACTAT pLKO.1 732 CDS 100% 4.950 3.465 N CD300A n/a
2 TRCN0000159812 GATGTTTCAGAAATGGATCAA pLKO.1 665 CDS 100% 4.950 3.465 N CD300A n/a
3 TRCN0000159637 GATTCAGATTACAGTGTGATA pLKO.1 819 CDS 100% 4.950 3.465 N CD300A n/a
4 TRCN0000164646 GCCTGGAGGATGTTTCAGAAA pLKO.1 657 CDS 100% 4.950 3.465 N CD300A n/a
5 TRCN0000164156 CAGTGTCCCTATGAGAAGGAA pLKO.1 162 CDS 100% 3.000 1.800 N CD300A n/a
6 TRCN0000163886 CCCTCAACAAATACTGGTGCA pLKO.1 190 CDS 100% 2.160 1.296 N CD300A n/a
7 TRCN0000163993 CGAGACTTTCATGATCCCGTT pLKO.1 390 CDS 100% 2.160 1.296 N CD300A n/a
8 TRCN0000062981 GACAAGATTGTGGAGACCAAA pLKO.1 234 CDS 100% 4.950 2.475 Y CD300C n/a
9 TRCN0000163279 GAGAATCTCACAGAGGAGGAT pLKO.1 330 CDS 100% 2.640 1.320 Y CD300A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005256990.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07796 pDONR223 100% 87.8% 87.6% None 665_666ins108;782G>N n/a
2 ccsbBroad304_07796 pLX_304 0% 87.8% 87.6% V5 665_666ins108;782G>N n/a
3 TRCN0000479246 ATCACGCCCTACTTCTCGTCGCGG pLX_317 40% 87.8% 87.6% V5 665_666ins108;782G>C n/a
Download CSV