Transcript: Human XM_005257005.3

PREDICTED: Homo sapiens cytoglobin (CYGB), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CYGB (114757)
Length:
2141
CDS:
199..807

Additional Resources:

NCBI RefSeq record:
XM_005257005.3
NBCI Gene record:
CYGB (114757)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005257005.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059382 CGGTGTACTTCAAGATCCTCT pLKO.1 560 CDS 100% 2.640 3.696 N CYGB n/a
2 TRCN0000059380 GCCCTCAAGCACAAGGTGGAA pLKO.1 538 CDS 100% 0.880 0.616 N CYGB n/a
3 TRCN0000059379 CCTGGTGAGGTTCTTTGTGAA pLKO.1 333 CDS 100% 4.950 2.970 N CYGB n/a
4 TRCN0000059381 GCAGTACTTCAGCCAGTTCAA pLKO.1 369 CDS 100% 4.950 2.970 N CYGB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005257005.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09397 pDONR223 100% 90.4% 88.7% None (many diffs) n/a
2 ccsbBroad304_09397 pLX_304 0% 90.4% 88.7% V5 (many diffs) n/a
3 TRCN0000491965 TAGGTGAGCCTATTTCAATACAAC pLX_317 71% 90.4% 88.7% V5 (many diffs) n/a
Download CSV