Transcript: Human XM_005257100.3

PREDICTED: Homo sapiens membrane associated ring-CH-type finger 10 (MARCHF10), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MARCHF10 (162333)
Length:
3060
CDS:
288..2765

Additional Resources:

NCBI RefSeq record:
XM_005257100.3
NBCI Gene record:
MARCHF10 (162333)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005257100.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073213 CAAAGCGTTCACAGTTAGATT pLKO.1 2775 3UTR 100% 5.625 7.875 N MARCHF10 n/a
2 TRCN0000073216 CAAGGTCATCTATCAAGATAT pLKO.1 529 CDS 100% 13.200 9.240 N MARCHF10 n/a
3 TRCN0000430788 CTAAATCCACAGGGCAATTTG pLKO_005 1977 CDS 100% 13.200 9.240 N MARCHF10 n/a
4 TRCN0000433197 GAAGCAGAAGATACTACTTTA pLKO_005 1914 CDS 100% 13.200 9.240 N MARCHF10 n/a
5 TRCN0000414976 GCCAAACCTGAGGAGATTTAC pLKO_005 707 CDS 100% 13.200 9.240 N MARCHF10 n/a
6 TRCN0000419203 GGGCCAAGAAAGGCATCATTT pLKO_005 1074 CDS 100% 13.200 9.240 N MARCHF10 n/a
7 TRCN0000426473 GTAAACAGTGCACACGAATTT pLKO_005 1884 CDS 100% 13.200 9.240 N MARCHF10 n/a
8 TRCN0000073214 CCTGGGTGACTTTAACATGAT pLKO.1 2450 CDS 100% 4.950 3.465 N MARCHF10 n/a
9 TRCN0000073215 GCATTTAAGTGTGACTCCAAA pLKO.1 552 CDS 100% 4.950 3.465 N MARCHF10 n/a
10 TRCN0000073217 GCACCCATGATTCTGAAGGAT pLKO.1 1582 CDS 100% 3.000 1.800 N MARCHF10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005257100.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14419 pDONR223 100% 79.5% 79.3% None (many diffs) n/a
2 ccsbBroad304_14419 pLX_304 0% 79.5% 79.3% V5 (many diffs) n/a
Download CSV