Transcript: Human XM_005257193.2

PREDICTED: Homo sapiens glucosidase alpha, acid (GAA), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GAA (2548)
Length:
3607
CDS:
199..3057

Additional Resources:

NCBI RefSeq record:
XM_005257193.2
NBCI Gene record:
GAA (2548)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005257193.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049554 CGCCTCCACTTCACGATCAAA pLKO.1 730 CDS 100% 5.625 7.875 N GAA n/a
2 TRCN0000049556 CAGGAATAACACGATCGTGAA pLKO.1 2838 CDS 100% 4.050 5.670 N GAA n/a
3 TRCN0000049553 CGCTACATGATGATCGTGGAT pLKO.1 1507 CDS 100% 2.640 3.696 N GAA n/a
4 TRCN0000290341 CGCTACATGATGATCGTGGAT pLKO_005 1507 CDS 100% 2.640 3.696 N GAA n/a
5 TRCN0000049555 CCAGTTTCTCTCCACACACTA pLKO.1 1884 CDS 100% 4.950 3.465 N GAA n/a
6 TRCN0000049557 GAGGGACTTCACGTTCAACAA pLKO.1 1431 CDS 100% 4.950 3.465 N GAA n/a
7 TRCN0000290342 GAGGGACTTCACGTTCAACAA pLKO_005 1431 CDS 100% 4.950 3.465 N GAA n/a
8 TRCN0000310233 GAACCTGAGCTCCTCTGAAAT pLKO_005 615 CDS 100% 13.200 7.920 N GAA n/a
9 TRCN0000308264 TGTTGATGGGAGAGCAGTTTC pLKO_005 3020 CDS 100% 10.800 6.480 N GAA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005257193.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06237 pDONR223 100% 99.9% 100% None 183C>T;2571G>T n/a
2 ccsbBroad304_06237 pLX_304 0% 99.9% 100% V5 183C>T;2571G>T n/a
3 TRCN0000481212 AGGTATCCGGATAATTGTTGGAAT pLX_317 14.4% 99.9% 100% V5 183C>T;2571G>T n/a
Download CSV