Transcript: Human XM_005257391.5

PREDICTED: Homo sapiens myosin light chain 4 (MYL4), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MYL4 (4635)
Length:
873
CDS:
94..687

Additional Resources:

NCBI RefSeq record:
XM_005257391.5
NBCI Gene record:
MYL4 (4635)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005257391.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054038 GCCATACCAGGGTGAGTTAAA pLKO.1 723 3UTR 100% 13.200 18.480 N MYL4 n/a
2 TRCN0000054040 GCCTGAAGAGATGAATGTCAA pLKO.1 399 CDS 100% 4.950 3.465 N MYL4 n/a
3 TRCN0000054039 GCTGGACTTTGAGACGTTCTT pLKO.1 423 CDS 100% 4.950 3.465 N MYL4 n/a
4 TRCN0000436634 CCCATCCTGCAGCACATTTCC pLKO_005 445 CDS 100% 1.650 1.155 N MYL4 n/a
5 TRCN0000054041 GATGCCAATGGCTGCATCAAT pLKO.1 631 CDS 100% 0.563 0.394 N MYL4 n/a
6 TRCN0000430903 GGGCCTGCGTGTCTTTGACAA pLKO_005 504 CDS 100% 1.650 0.990 N MYL4 n/a
7 TRCN0000054042 GCTCCCAAGGAACCTGCCTTT pLKO.1 190 CDS 100% 1.350 0.810 N MYL4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005257391.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.