Transcript: Human XM_005257557.3

PREDICTED: Homo sapiens serine carboxypeptidase 1 (SCPEP1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SCPEP1 (59342)
Length:
1809
CDS:
32..1276

Additional Resources:

NCBI RefSeq record:
XM_005257557.3
NBCI Gene record:
SCPEP1 (59342)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005257557.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051703 CCCTGTACAGTGACCCTAAAT pLKO.1 1119 CDS 100% 13.200 9.240 N SCPEP1 n/a
2 TRCN0000290861 CCCTGTACAGTGACCCTAAAT pLKO_005 1119 CDS 100% 13.200 9.240 N SCPEP1 n/a
3 TRCN0000051707 CCAGACAGTTCCATTCTACAT pLKO.1 499 CDS 100% 4.950 3.465 N SCPEP1 n/a
4 TRCN0000290926 CCAGACAGTTCCATTCTACAT pLKO_005 499 CDS 100% 4.950 3.465 N SCPEP1 n/a
5 TRCN0000051704 CCAGTCTCCTATTTGTGGATA pLKO.1 357 CDS 100% 4.950 3.465 N SCPEP1 n/a
6 TRCN0000290927 CCAGTCTCCTATTTGTGGATA pLKO_005 357 CDS 100% 4.950 3.465 N SCPEP1 n/a
7 TRCN0000051706 GTCCTACAAGAACCTTGCTTT pLKO.1 1165 CDS 100% 4.950 3.465 N SCPEP1 n/a
8 TRCN0000290862 GTCCTACAAGAACCTTGCTTT pLKO_005 1165 CDS 100% 4.950 3.465 N SCPEP1 n/a
9 TRCN0000051705 TCCTGCAAGAACTTCTCAGAA pLKO.1 212 CDS 100% 4.950 3.465 N SCPEP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005257557.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03877 pDONR223 100% 91.5% 91.5% None 878_879ins114 n/a
2 ccsbBroad304_03877 pLX_304 0% 91.5% 91.5% V5 878_879ins114 n/a
3 TRCN0000474742 GTCCGGAACCGTATGTTGGCGGTC pLX_317 28.5% 91.5% 91.5% V5 878_879ins114 n/a
4 ccsbBroadEn_12423 pDONR223 100% 71% 70.7% None 881_897del;901_902insGTT;903_1242del n/a
5 ccsbBroad304_12423 pLX_304 0% 71% 70.7% V5 881_897del;901_902insGTT;903_1242del n/a
6 TRCN0000470366 TTCTATTCTGAGCAGATGTTTCCC pLX_317 50.1% 71% 70.7% V5 881_897del;901_902insGTT;903_1242del n/a
Download CSV