Transcript: Human XM_005257688.2

PREDICTED: Homo sapiens dephospho-CoA kinase domain containing (DCAKD), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DCAKD (79877)
Length:
722
CDS:
219..617

Additional Resources:

NCBI RefSeq record:
XM_005257688.2
NBCI Gene record:
DCAKD (79877)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148979 GGGCTGTGCGGTGATTGACG pXPR_003 TGG 88 22% 2 0.5109 DCAKD DCAKD 75874
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005257688.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000382037 TGCTGGAGAACGGCGACATAA pLKO_005 391 CDS 100% 13.200 9.240 N DCAKD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005257688.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04143 pDONR223 100% 51.1% 48.9% None (many diffs) n/a
2 ccsbBroad304_04143 pLX_304 0% 51.1% 48.9% V5 (many diffs) n/a
3 TRCN0000468920 ACGAGTGCAACTTTACATCTACAT pLX_317 50.2% 51.1% 48.9% V5 (many diffs) n/a
4 ccsbBroadEn_15156 pDONR223 0% 51.1% 48.9% None (many diffs) n/a
5 ccsbBroad304_15156 pLX_304 0% 51.1% 48.9% V5 (many diffs) n/a
6 TRCN0000465914 ACAGGCTATCTCGGTAAAGTGATA pLX_317 35.9% 51.1% 48.9% V5 (many diffs) n/a
Download CSV