Construct: ORF TRCN0000465914
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009863.2_s317c1
- Derived from:
- ccsbBroadEn_15156
- DNA Barcode:
- ACAGGCTATCTCGGTAAAGTGATA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DCAKD (79877)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465914
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 79877 | DCAKD | dephospho-CoA kinase domain... | NM_001128631.3 | 100% | 100% | |
| 2 | human | 79877 | DCAKD | dephospho-CoA kinase domain... | NM_001288654.2 | 100% | 100% | |
| 3 | human | 79877 | DCAKD | dephospho-CoA kinase domain... | NM_001288655.2 | 100% | 100% | |
| 4 | human | 79877 | DCAKD | dephospho-CoA kinase domain... | NM_001321326.2 | 100% | 100% | |
| 5 | human | 79877 | DCAKD | dephospho-CoA kinase domain... | NM_024819.7 | 100% | 100% | |
| 6 | human | 79877 | DCAKD | dephospho-CoA kinase domain... | XM_011525262.2 | 100% | 100% | |
| 7 | human | 79877 | DCAKD | dephospho-CoA kinase domain... | XM_017025105.1 | 55.2% | 54.3% | 0_1ins285;5_8delGCCC;13_13delAins23 |
| 8 | human | 79877 | DCAKD | dephospho-CoA kinase domain... | XM_005257688.2 | 51.1% | 48.9% | (many diffs) |
| 9 | human | 79877 | DCAKD | dephospho-CoA kinase domain... | XM_017025103.1 | 51.1% | 48.9% | (many diffs) |
| 10 | human | 79877 | DCAKD | dephospho-CoA kinase domain... | XM_017025104.1 | 51.1% | 48.9% | (many diffs) |
| 11 | human | 79877 | DCAKD | dephospho-CoA kinase domain... | XR_002958070.1 | 47.2% | 1_292del;609_716del;916_917ins177 | |
| 12 | mouse | 68087 | Dcakd | dephospho-CoA kinase domain... | NM_026551.3 | 86% | 90.9% | (many diffs) |
| 13 | mouse | 68087 | Dcakd | dephospho-CoA kinase domain... | XM_006534038.2 | 86% | 90.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 759
- ORF length:
- 693
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtt tctggtgggc ctgacagggg gcattgcctc aggcaagagc tcagtgatcc 121 aggtgttcca gcagctgggc tgtgcggtga ttgacgtgga cgtgatggcc cggcacgtcg 181 tgcagccagg ataccctgcc caccggcgca tcgtagaggt cttcggcact gaggtcttgc 241 tggagaacgg cgacataaat cgcaaggtcc tgggggacct gatctttaac cagcctgacc 301 ggcggcagct gctcaacgcc atcacccacc ccgagattcg caaggagatg atgaaggaga 361 cgttcaagta cttcctccgg ggataccgct acgtgattct ggatatcccc ctgctgtttg 421 agaccaagaa gttgctcaag tacatgaagc acaccgtggt agtatactgc gaccgggaca 481 cacagctggc acggctgatg cggcggaaca gccTGAACCG CAAGGACGCA GAGGCCCGCA 541 TCAATGCCCA GCTGCCCCTG ACAGACAAGG CCCGCATGGC CCGCCATGTC CTAGACAACT 601 CGGGCGAGTG GAGTGTCACC AAACGCCAGG TCATCCTCTT GCACACTGAG CTGGAGCGCT 661 CCCTGGAGTA CCTGCCGCTG AGGTTTGGGG TCCTCACAGG GCTCGCTGCC ATTGCCAGCC 721 TCCTCTACCT GCTCACCCAC TACCTTCTGC CTTACGCCTA CCCAACTTTC TTGTACAAAG 781 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 841 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 901 ACGAACAGGC TATCTCGGTA AAGTGATAAC GCGTTAAGTC gacaatcaac ctctggatta 961 caaaatttgt gaaagatt