Transcript: Human XM_005257779.3

PREDICTED: Homo sapiens centrosomal protein 95 (CEP95), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CEP95 (90799)
Length:
3466
CDS:
339..2807

Additional Resources:

NCBI RefSeq record:
XM_005257779.3
NBCI Gene record:
CEP95 (90799)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005257779.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434203 GGTTGACCCAATCAAAGATAA pLKO_005 2287 CDS 100% 13.200 18.480 N CEP95 n/a
2 TRCN0000419968 TGCTCTGGGTGATCGGATTAA pLKO_005 1502 CDS 100% 13.200 18.480 N CEP95 n/a
3 TRCN0000427493 ATCCGAGCAGCTATTCCTTTA pLKO_005 1107 CDS 100% 10.800 15.120 N CEP95 n/a
4 TRCN0000413498 GGTCAGCTTGTCTCACATAAC pLKO_005 572 CDS 100% 10.800 8.640 N CEP95 n/a
5 TRCN0000438050 GTGATGGCATCGTGGAGTATG pLKO_005 1603 CDS 100% 10.800 8.640 N CEP95 n/a
6 TRCN0000418804 ACTGGAGAGCATACGGAATTT pLKO_005 1221 CDS 100% 13.200 9.240 N CEP95 n/a
7 TRCN0000434054 TTAATTTCCAAGTTGCCTAAA pLKO_005 1269 CDS 100% 10.800 7.560 N CEP95 n/a
8 TRCN0000121527 CCATTGCCAATAACCTTCTTT pLKO.1 367 CDS 100% 5.625 3.938 N CEP95 n/a
9 TRCN0000141601 CTGGAGCAGTTTCCGTTTCTT pLKO.1 2046 CDS 100% 5.625 3.938 N CEP95 n/a
10 TRCN0000144120 CAGTGAAACATCTCATGAGAA pLKO.1 683 CDS 100% 4.950 3.465 N CEP95 n/a
11 TRCN0000122493 CCTTTGTTGAAGACACGGAAA pLKO.1 1039 CDS 100% 4.050 2.835 N CEP95 n/a
12 TRCN0000144867 GAAAGGGAACTAAGAAGACAT pLKO.1 1803 CDS 100% 4.950 2.970 N CEP95 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005257779.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04530 pDONR223 100% 93.6% 91.5% None (many diffs) n/a
2 ccsbBroad304_04530 pLX_304 0% 93.6% 91.5% V5 (many diffs) n/a
3 TRCN0000469354 CGCTTCCCCGTCCTACGAAGTTAC pLX_317 13.9% 93.6% 91.5% V5 (many diffs) n/a
Download CSV