Transcript: Human XM_005257938.3

PREDICTED: Homo sapiens adaptor related protein complex 2 subunit beta 1 (AP2B1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AP2B1 (163)
Length:
4009
CDS:
198..3053

Additional Resources:

NCBI RefSeq record:
XM_005257938.3
NBCI Gene record:
AP2B1 (163)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005257938.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151713 CATCGTAAACACTTGCCAATT pLKO.1 1962 CDS 100% 10.800 8.640 N AP2B1 n/a
2 TRCN0000151660 GCAACACAGGATTCTGATAAT pLKO.1 1725 CDS 100% 13.200 9.240 N AP2B1 n/a
3 TRCN0000382390 AGTGGTGCTTTCAGCGGTAAA pLKO_005 959 CDS 100% 10.800 7.560 N AP2B1 n/a
4 TRCN0000158212 CCAATCCCTGAAGCTCACTAA pLKO.1 2903 CDS 100% 4.950 3.465 N AP2B1 n/a
5 TRCN0000150775 GAAGAAAGTGATTGCTGCTAT pLKO.1 299 CDS 100% 4.950 3.465 N AP2B1 n/a
6 TRCN0000150303 GCTTGTGTATCTCTACTTGAT pLKO.1 398 CDS 100% 4.950 3.465 N AP2B1 n/a
7 TRCN0000156576 GAGAACTTAGACTCGCTGGAT pLKO.1 1497 CDS 100% 2.640 1.848 N AP2B1 n/a
8 TRCN0000152841 GCTTGATCTAATCCAGACCAA pLKO.1 1382 CDS 100% 2.640 1.848 N AP2B1 n/a
9 TRCN0000100496 CCCAACAAGTATGAAAGTATT pLKO.1 1461 CDS 100% 13.200 9.240 N Ap2b1 n/a
10 TRCN0000100499 GCAGCTATGATTTGGATTGTA pLKO.1 1533 CDS 100% 5.625 3.938 N Ap2b1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005257938.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05789 pDONR223 100% 99.9% 100% None 2061G>C n/a
2 ccsbBroad304_05789 pLX_304 0% 99.9% 100% V5 2061G>C n/a
3 TRCN0000479045 CGAGCACTCCCATAGAACCCCGCG pLX_317 13.3% 99.9% 100% V5 2061G>C n/a
Download CSV