Transcript: Human XM_005258832.4

PREDICTED: Homo sapiens SERTA domain containing 3 (SERTAD3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SERTAD3 (29946)
Length:
1620
CDS:
383..973

Additional Resources:

NCBI RefSeq record:
XM_005258832.4
NBCI Gene record:
SERTAD3 (29946)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005258832.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107734 GCTCCGCATCTCCCTAGACAA pLKO.1 481 CDS 100% 1.650 2.310 N SERTAD3 n/a
2 TRCN0000432939 TGGGTCTTCCTGAATTAATTT pLKO_005 1164 3UTR 100% 15.000 10.500 N SERTAD3 n/a
3 TRCN0000441472 GGCCTCCTTTGTTCCCATTTC pLKO_005 1081 3UTR 100% 10.800 7.560 N SERTAD3 n/a
4 TRCN0000107732 CCTGATCCAGTCTTCTTAGAA pLKO.1 767 CDS 100% 5.625 3.938 N SERTAD3 n/a
5 TRCN0000107730 GCCTCAGGGAAGATAAAGAAA pLKO.1 1292 3UTR 100% 5.625 3.938 N SERTAD3 n/a
6 TRCN0000107731 CTCATCCATAACACCCTCCAA pLKO.1 551 CDS 100% 2.640 1.848 N SERTAD3 n/a
7 TRCN0000107733 CAGCCTGATCCAGTCTTCTTA pLKO.1 764 CDS 100% 5.625 3.375 N SERTAD3 n/a
8 TRCN0000173087 CAGATGAGGAAACTGAGGCTT pLKO.1 95 5UTR 100% 2.640 1.320 Y FLJ45966 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005258832.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08144 pDONR223 100% 99.8% 99.4% None 7G>C n/a
2 ccsbBroad304_08144 pLX_304 0% 99.8% 99.4% V5 7G>C n/a
3 TRCN0000468527 TACGCTCCTTCCTAAAGCTCCAGT pLX_317 73.1% 99.8% 99.4% V5 7G>C n/a
Download CSV