Transcript: Human XM_005258940.3

PREDICTED: Homo sapiens lipase E, hormone sensitive type (LIPE), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LIPE (3991)
Length:
2733
CDS:
106..2433

Additional Resources:

NCBI RefSeq record:
XM_005258940.3
NBCI Gene record:
LIPE (3991)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005258940.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427424 TGCATAAGGGATGCTTCTATG pLKO_005 581 CDS 100% 10.800 15.120 N LIPE n/a
2 TRCN0000442586 TCCTGCACAAATCCCGCTATG pLKO_005 362 CDS 100% 6.000 4.800 N LIPE n/a
3 TRCN0000052148 CCCTCCGATGTCAACTTCTTA pLKO.1 1918 CDS 100% 5.625 4.500 N LIPE n/a
4 TRCN0000440990 GAGCTCAGCAGCCTGATAAAG pLKO_005 1054 CDS 100% 13.200 9.240 N LIPE n/a
5 TRCN0000438312 GCTGTCAGCTGAGACACTTAG pLKO_005 1887 CDS 100% 10.800 7.560 N LIPE n/a
6 TRCN0000052151 CCTGGAGTTAAGTGGGCGCAA pLKO.1 1695 CDS 100% 0.720 0.504 N LIPE n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005258940.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488003 TTTTCGTCCCAAATCAATGTTCCC pLX_317 1% 72% 71.9% V5 0_1ins903;2325_2326insG n/a
Download CSV