Transcript: Human XM_005259256.3

PREDICTED: Homo sapiens pleckstrin homology and FYVE domain containing 1 (PLEKHF1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLEKHF1 (79156)
Length:
2028
CDS:
136..1230

Additional Resources:

NCBI RefSeq record:
XM_005259256.3
NBCI Gene record:
PLEKHF1 (79156)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005259256.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431032 GGTAACAAACGCCACCTTACA pLKO_005 1464 3UTR 100% 4.950 6.930 N PLEKHF1 n/a
2 TRCN0000163979 CTTTAACGACATCCTGGTGTA pLKO.1 561 CDS 100% 4.050 5.670 N PLEKHF1 n/a
3 TRCN0000425012 CCACAGGTCTTGGTAACAAAC pLKO_005 1453 3UTR 100% 10.800 7.560 N PLEKHF1 n/a
4 TRCN0000165370 GATGATCAAGACGGCCAAGAA pLKO.1 690 CDS 100% 4.950 3.465 N PLEKHF1 n/a
5 TRCN0000429627 AGCAGGTTTGGGAACACAGAG pLKO_005 1562 3UTR 100% 4.050 2.835 N PLEKHF1 n/a
6 TRCN0000417119 AGGTAATGCCTTTCCCTTCAG pLKO_005 1417 3UTR 100% 4.050 2.835 N PLEKHF1 n/a
7 TRCN0000414485 GTATGGCAGCATCGTGCTCAA pLKO_005 579 CDS 100% 4.050 2.835 N PLEKHF1 n/a
8 TRCN0000427068 GTCCAGTGGAGATGACGATGA pLKO_005 1113 CDS 100% 4.050 2.835 N PLEKHF1 n/a
9 TRCN0000166611 CCAAGAAGTCCTTTGTGGTGT pLKO.1 704 CDS 100% 2.640 1.848 N PLEKHF1 n/a
10 TRCN0000165241 GAATGGATTAGCCACATCGAG pLKO.1 751 CDS 100% 2.640 1.848 N PLEKHF1 n/a
11 TRCN0000166466 CAAGAAGTCCTTTGTGGTGTC pLKO.1 705 CDS 100% 2.250 1.575 N PLEKHF1 n/a
12 TRCN0000163236 GCGCATCTTCTTCCTCTTTAA pLKO.1 546 CDS 100% 13.200 7.920 N PLEKHF1 n/a
13 TRCN0000435009 GATGGGAGTGTAGCCACAGAA pLKO_005 1592 3UTR 100% 4.950 2.970 N PLEKHF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005259256.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04058 pDONR223 100% 76.6% 76.6% None 1_255del n/a
2 ccsbBroad304_04058 pLX_304 0% 76.6% 76.6% V5 1_255del n/a
3 TRCN0000468447 GACCTGTTTCGTCGAAATTTACAG pLX_317 26.8% 76.6% 76.6% V5 1_255del n/a
Download CSV