Transcript: Human XM_005259385.4

PREDICTED: Homo sapiens Yip1 interacting factor homolog B, membrane trafficking protein (YIF1B), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
YIF1B (90522)
Length:
1474
CDS:
385..1236

Additional Resources:

NCBI RefSeq record:
XM_005259385.4
NBCI Gene record:
YIF1B (90522)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005259385.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257108 TAAGAACATCGACCGCTTCAT pLKO_005 582 CDS 100% 4.950 6.930 N YIF1B n/a
2 TRCN0000179907 CGTAGCCATCTTTGTGTTCAT pLKO.1 1059 CDS 100% 4.950 3.960 N YIF1B n/a
3 TRCN0000244659 TGGCCTTCTTGGGCTACAAAT pLKO_005 959 CDS 100% 13.200 9.240 N YIF1B n/a
4 TRCN0000244660 CATCACCAAGCTCAAGTATTA pLKO_005 606 CDS 100% 13.200 7.920 N YIF1B n/a
5 TRCN0000244658 TGGCTTTCATCACCTACGTTT pLKO_005 776 CDS 100% 4.950 2.970 N YIF1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005259385.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12941 pDONR223 100% 78.8% 71.7% None (many diffs) n/a
2 ccsbBroad304_12941 pLX_304 0% 78.8% 71.7% V5 (many diffs) n/a
3 TRCN0000467621 CGACGAAGTTCTCCGTGTCATCAA pLX_317 26.1% 78.8% 71.7% V5 (many diffs) n/a
Download CSV