Transcript: Human XM_005259690.3

PREDICTED: Homo sapiens cell division cycle 34 (CDC34), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDC34 (997)
Length:
1064
CDS:
213..1022

Additional Resources:

NCBI RefSeq record:
XM_005259690.3
NBCI Gene record:
CDC34 (997)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005259690.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007302 CTTTCGGTTCCTGACCAAGAT pLKO.1 434 CDS 100% 4.950 6.930 N CDC34 n/a
2 TRCN0000293373 CTTTCGGTTCCTGACCAAGAT pLKO_005 434 CDS 100% 4.950 6.930 N CDC34 n/a
3 TRCN0000007300 TCGGGAGTACACAGACATCAT pLKO.1 686 CDS 100% 4.950 6.930 N CDC34 n/a
4 TRCN0000293375 TCGGGAGTACACAGACATCAT pLKO_005 686 CDS 100% 4.950 6.930 N CDC34 n/a
5 TRCN0000293297 GGTGGACGAGGGCGATCTATA pLKO_005 308 CDS 100% 4.400 6.160 N CDC34 n/a
6 TRCN0000007303 ACGCAGAACGTCAGGACCATT pLKO.1 561 CDS 100% 4.950 3.465 N CDC34 n/a
7 TRCN0000007301 GAGTGTGATCTCCCTCCTGAA pLKO.1 587 CDS 100% 4.050 2.835 N CDC34 n/a
8 TRCN0000293295 GAGTGTGATCTCCCTCCTGAA pLKO_005 587 CDS 100% 4.050 2.835 N CDC34 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005259690.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00274 pDONR223 100% 76.3% 63.6% None (many diffs) n/a
2 ccsbBroad304_00274 pLX_304 0% 76.3% 63.6% V5 (many diffs) n/a
3 TRCN0000480218 TCGAACTCATATTTCAATCACCTA pLX_317 54.8% 76.3% 63.6% V5 (many diffs) n/a
Download CSV