Construct: ORF TRCN0000480218
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008306.1_s317c1
- Derived from:
- ccsbBroadEn_00274
- DNA Barcode:
- TCGAACTCATATTTCAATCACCTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CDC34 (997)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480218
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 997 | CDC34 | cell division cycle 34 | NM_004359.2 | 100% | 100% | |
2 | human | 997 | CDC34 | cell division cycle 34 | XM_005259690.3 | 76.3% | 63.6% | (many diffs) |
3 | human | 997 | CDC34 | cell division cycle 34 | XM_006722952.2 | 75.8% | 70.4% | 496_497insGGAA;537_538ins167 |
4 | mouse | 216150 | Cdc34 | cell division cycle 34 | NM_177613.2 | 90.8% | 99.1% | (many diffs) |
5 | mouse | 216150 | Cdc34 | cell division cycle 34 | XM_017313887.1 | 90.8% | 99.1% | (many diffs) |
6 | mouse | 216150 | Cdc34 | cell division cycle 34 | XM_017313888.1 | 90.8% | 99.1% | (many diffs) |
7 | mouse | 216150 | Cdc34 | cell division cycle 34 | XM_006513482.2 | 74% | 80% | (many diffs) |
8 | mouse | 216150 | Cdc34 | cell division cycle 34 | XM_006513483.2 | 68.3% | 67.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 774
- ORF length:
- 708
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc tcggccgcta gtgcccagct cgcagaaggc gctgctgctg gagctcaagg 121 ggctgcagga agagccggtc gagggattcc gcgtgacact ggtggacgag ggcgatctat 181 acaactggga ggtggccatc ttcgggcccc ccaacaccta ctacgagggc ggctacttca 241 aggcgcgcct caagttcccc atcgactacc catactctcc accagccttt cggttcctga 301 ccaagatgtg gcaccctaac atctacgaga cgggggacgt gtgtatctcc atcctccacc 361 cgccggtgga cgacccccag agcggGGAGC TGCCCTCAGA GAGGTGGAAC CCCACGCAGA 421 ACGTCAGGAC CATTCTCCTG AGTGTGATCT CCCTCCTGAA CGAGCCCAAC ACCTTCTCGC 481 CCGCAAACGT GGACGCCTCC GTGATGTACA GGAAGTGGAA AGAGAGCAAG GGGAAGGATC 541 GGGAGTACAC AGACATCATC CGGAAGCAGG TCCTGGGGAC CAAGGTGGAC GCGGAGCGTG 601 ACGGCGTGAA GGTGCCCACC ACGCTGGCCG AGTACTGCGT GAAGACCAAG GCGCCGGCGC 661 CCGACGAGGG CTCAGACCTC TTCTACGACG ACTACTACGA GGACGGCGAG GTGGAGGAGG 721 AGGCCGACAG CTGCTTCGGG GACGATGAGG ATGACTCTGG CACGGAGGAG TCCTGCCCAA 781 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 841 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 901 TATCTTGTGG AAAGGACGAT CGAACTCATA TTTCAATCAC CTAACGCGTT AAGTCgacaa 961 tcaacctctg gattacaaaa tttgtgaaag att