Transcript: Human XM_005260412.3

PREDICTED: Homo sapiens agouti signaling protein (ASIP), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ASIP (434)
Length:
2642
CDS:
2055..2465

Additional Resources:

NCBI RefSeq record:
XM_005260412.3
NBCI Gene record:
ASIP (434)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005260412.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083810 TGAACCTACTGGATGTCCCTT pLKO.1 2191 CDS 100% 2.640 3.696 N ASIP n/a
2 TRCN0000083811 GAAGGAGGCTTCGATGAAGAA pLKO.1 2288 CDS 100% 4.950 3.465 N ASIP n/a
3 TRCN0000083808 GCGCTGAACAAGAAATCCAAA pLKO.1 2226 CDS 100% 4.950 3.465 N ASIP n/a
4 TRCN0000083812 GCTGAACAAGAAATCCAAACA pLKO.1 2228 CDS 100% 4.950 3.465 N ASIP n/a
5 TRCN0000083809 GATCTTCTAAGAAGGAGGCTT pLKO.1 2278 CDS 100% 2.640 1.848 N ASIP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005260412.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00111 pDONR223 100% 97% 97% None 1_12del n/a
2 ccsbBroad304_00111 pLX_304 0% 97% 97% V5 1_12del n/a
3 TRCN0000471929 GGATATTAACCTTCGAGTTGGTTT pLX_317 78.7% 97% 97% V5 1_12del n/a
Download CSV